Citation :

Adamu J, Momoh O.M, Tor N.E.T, Ukwu H.O, 2024. "Mitochondrial DNA Variation and Genetic diversity of Donkeys in Sahel Agro – Ecological Zone of Nigeria" ESP International Journal of Advancements in Science & Technology (ESP-IJAST)  Volume 2, Issue 1: 1-7.

Abstract :

A great field for ensuring that genetic variation is preserved in any particular species is genetic diversity analysis. The study's goals were to assess the molecular genetic diversity and determine the evolutionary history of Nigeria's Sahel agro-ecological donkeys. For the investigation, twenty (20) samples from Borno and Yobe states and sixty-six sequences from the gene bank were employed. The methodology for extracting genomic DNA was followed (Accu prep Genomic DNA extraction kit from Bioneer), and polymerization was carried out at DNA Lab Kaduna utilising donkey MTF primers (forward primer: 5' TAGCTCCACCATCAACACCC 3'; reverse primer: 5' GCATTTTCAGTGCCTTGCT 3'). PCR amplicons were sequenced at the Inqaba Biotech facility in West Africa using the Sanger di-deoxy chain termination method.Uncertain bases were checked and corrected using the Bio Edit programme. MEGAX's ClustalW programme was utilised to align various sequences. DnaSPver 6.0 was used to analyse the numbers of haplotypes, nucleotide polymorphic sites, haplotype diversity (h), and nucleotide diversity (π). Median Joining Network in NETWORK v 10.1 was used to construct the haplotype joining network, and Arlequin software version 3.5 was used to analyse Tajima's test of neutrality (D). The current study's high Hd = 0.87 and negative Tajima D observation suggest that populations are expanding or undergoing purifying selection. When measuring genetic distance, the estimates of (Fst) and Nst were applied, and the results were low for numerous alleles. This indicates that there was little variation in the allele frequency of these genes within the population.The findings reveal that there is no structured population in the population of donkeys (Fst values were not significant at p<0.05).Three clades were found by the evolutionary analysis. All of this category includes the research area. Equine Nubians, Equine Asinus Somalis, and Clade C comprise African wild donkey clade members. These groups' many subclades describe founder effect and expansion from a set of founder mitochondrial DNA haplotypes.

References :

[1] Achilli, A., Olivieri, A. and Pellecchia, M. (2008) Mitochondrial genomes of extinct aurochs survive in domestic cattle. Journal of current Biology12.

[2] Agaviezor, B.O.,Ajayi,F.O.and Omayiho, T. W.(2017). Bone morpho genetic protein 3(BMP3) gene variation in some livestock animals. Nigerian Journal of Biotechnology. Vol. 32.28-32.

[3] Anila, H., Yili, B. and Petrit, D. (2014). Genetic diversity of Albanian goat by mtDNA sequence variation ISSN: 1310-2818 (print) 1314-3530

[4] Bruford M.W., Bradley D.G. and Luikart G. (2003) DNA markers reveal the complexity of livestock domestication. Nature Reviews Genetics 4, 900–10.

[5] Chen, S., Zhou, F., Xiao, H., Sha, T., Wu, S. and Zhang, Y. (2006). Mitochondrial DNA diversity and population structure of four Chinese donkey breeds. Animal Genetics 37:427-429.

[6] Diamond, J. (2002). Evolution, consequences and future of plant and animal domestication. Nature, 418: 700707.

[7] Earnist, S.,Nawaz, S.,Ullah, I.,Bhinder, M.A., Imran, M.,Rasheed, M.A., Shehzad, W. and Zahoor, M.Y.(2021). Mitochondrial DNA diversity and maternal origins of Pakistani donkeys. Journal of Brazilian Biology. 1-6 ISSN 1519-6984

[7] FOOD AND AGRICULTURE ORGANIZATION (FAO). (2003). Rapport natural resources.www.fao.org/docrep/pdf/010/a1250e/annexes/CountryReports/Algeria

[8] FAO. (1991). Climate smart Agriculture in Borno state of Nigeria. Climate smart Agriculture (CSA) pp 1- 11

[9] FAO. (2011). http://www.fao.org/docrep/013/i2050e/i2050e00.htm

[10] Felsenstein, J. (1985). Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39:783-791.

[11] Groeneveld, L. F., Lenstra, J.A., Eding, H., Toro, M.A., Scherf, B., Pilling, D., Negrini, R., Finlay,E.K., Jianlin, H., Groeneveld, E., Weigend, S. and GLOBALDIV, C.(2010). Genetic diversity in farm animal. A review.

[12] Gupta, A.K., Kumar, S., Pal, Y., Bhardwaj, A., Chauhan, M. and Kumar, B., (2018). Genetic Diversity and Structure Analysis of Donkey Population Clusters in Different Indian Agro-climatic Regions.

[13] Hedrick, P.W. (2005). A standardized genetic differentiation measure. Evolution, 59, 1633– 1638.

[14] Jobling, M.A., Hurles, M.E. and Tyler-smith, C. (2004). Human Evolutionary Genetics. Garland science, New York/ Abingdon, UK.

[15] Kefena, E., Dessie, T., Tegegne, A., Beja-pereira, A., Kurtu, M.Y., Rosenbom, S. and Han, J.L., (2014). Genetic diversity and matrilineal genetic signature of native Ethiopian donkeys (Equusasinus) inferred from mitochondrial DNA sequence polymorphism. Livestock Science, vol. 167, no. 1, pp. 73-79. http://dx.doi.org/10.1016/j.livsci.2014.06.006.

[16] Kimura, B., Marshall, F.B., Chen, S., Rosenbom, S., Moehlman, P.D., Tuross, N., Sabin, R.C., Peters, J., Barich, B., Yohannes, H. and Kebede, F., 2011. Ancient DNA from Nubian and Somali Wild ass Provides Insights into Donkey Ancestry and Domestication. Proceedings of the Royal Society B: Biological Sciences. 278(1702): 50-57.

[17] Kumar, S., Stecher, G., Li, M., Knyaz, C., and Tamura, K. (2018). MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Molecular Biology and Evolution 35:1547-1549.

[18] Meirmans, P.G. and Hedrick, P.W. (2011). Assessing population structure: FST and related measures. Mol. Ecol. Res. 11: 5–18.

[19] Neaves, L.E., Whitlock, R., Piertney, S.B., Burke, T., Butlin, R.K. Hollingsworth, P. M. (2015) . Biodiversity Climate Change impacts report card technical paper. Genetics, Biodiversity Report Card paper 15.

[20] Nei, M. and Kumar, S. (2000). Molecular Evolution and Phylogenetic. Oxford University Press, New York.

[21] Pearson, A. and Ouassat, M. (2000). A Guide to Live Weight Estimation and Body Condition Scoring of Donkeys. Centre for Tropical Veterinary Medicine University of Edinburgh. P21.

[22] Pereira, A.B., Philip, R., England, N.F.,Jordan, S.,Amel, O., Bakhiet, O., Mohammed, A., Abdalla, M.M,Jordan, J.,Taberiet, P. and Luikart, G. (2004). African origins of the domestic donkey.Journal of Science Vol 304:1781

[23] Perez-Pardal, L.,Grizeij, J. and Traore, A. (2011). Lack of mitochondrial DNA structure in Balkan donkeys consistant with a quick spread of the species after domestication. Animal science 45:144-147

[24] Rogers, A.R. (1995). Genetic evidence for a Pleistocene population expansion. Evolution, 49:608-615.

[25] Schneider, S., and Excoffier, L. (1999). Estimation of past demographic parameters from the distribution of pairwise differences when the mutation rates vary among sites: application to human mitochondrial DNA. Genetics 152:1079-1089.

[26] Tajima, F. (1996). The amount of DNA polymorphism maintained in a finite population when the neutral mutation rate varies among sites. Genetics 143: 1457-1465

[27] Tor, N.E.T., Ajibike, A.B., Oladejo,O., Shems, R.,Adebambo, A.O., Omotosu, A.O.,Toper, W.,Wanagi,T.J.,Collins, N.K. and Ofori, S.A.(2021). Genetic diversity and maternal ancestry of Liberian country chickens indicated at the hyper- variable 1-section of the mitochondrial DNA-loop. International Journal of Agriculture and Bioscience 10(2):107-113

[28] Unnati, A. B., Nayam, S. V., Goutam, U., Legha, R. A., Pal, Y., Kumar, J., Giri, K. A.andTripath, B. N. (2022). Mitochondrial - DNA variation and genetic relationship in Indian Halari Donkey Breed using D-loop Region. Indian Journal of Animal Reasearch. Dol: 10:18805/IJAR.B.4912.

[29] Wang, L., Sheng, G., Preick, M., Hu, J., Xiao, B., Sun, G., Song, S., Hou, X., Lai, X., Forfeiter, M.and Yuan, J. (2021). Ancient metagenomes provide new sight into origin and early introduction of Chinese domestic donkey. Livestock Genomics Journal of frontier genetics 12:75983

[30] Wolf, P. G. and Soltis, P.S. (1991). Genetic relationships and patterns of Allozyma divergence in the Ipomopsis Aggregation complex and related Taxa.American Journal of Botany 78:515-521

[31] Wright, S. (1969). Evolution and the Genetics of Populations, Vol. 2. University of Chicago Press, Chicago pp 1-3

Keywords :

Mitochondrial, Diversity, Donkeys, Evolution, Sahel.